Description
The CleanPlex Dual-Indexed PCR Primers for Illumina are high-quality ready-to-use PCR primers for Illumina library construction. They are compatible and designed for use with all CleanPlex and CleanPlex UMI NGS Panels to construct targeted libraries for sequencing on an Illumina NGS platform.
Primer Sequences:
i5 Indexed Primers
5’AATGATACGGCGACCACCGAGATCTACACXXXXXXXXACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3′
i7 Indexed Primers
5’-CAAGCAGAAGACGGCATACGAGATXXXXXXXXGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3’
Note:
Please refer to CleanPlex NGS Panel User Guide for instructions on using CleanPlex Dual-Indexed PCR Primers for Illumina
CleanPlex Dual-Indexed PCR primers for Illumina Set A1 has been discountinued.
For Research Use Only. Not for use in diagnostic procedures.