CleanPlex for MGI Single-Indexed PCR Primers, Set A (32 reactions)

£295.00

32 reactions (16 indexes)

SKU: 318001 Category: Tag:

Description

The CleanPlex for MGI Single-Indexed PCR Primers are high-quality ready-to-use PCR primers for MGISEQ™ library construction. They are compatible and designed for use with all CleanPlex for MGI NGS Panels to construct targeted libraries for sequencing on an MGISEQ NGS platform.

Primer Sequences:

Each sample is indexed by a pair of Indexed PCR Primers for sequencing on MGISEQ platforms.
XXXXXXXXXX denotes the index region of the primer.

Universal Primer

5′-Phos-GAACGACATGGCTACGATCCGACT*T-3’

Indexed Primers

5′-TGTGAGCCAAGGAGTTGXXXXXXXXXXTTGTCTTCCTAAGACCGCTTGGCCTCCGACT*T-3’

Note:

Please refer to the CleanPlex for MGI NGS Panel User Guide for instructions on using CleanPlex for MGI Single-Indexed PCR Primers

Menu