Description
The CleanPlex for MGI Single-Indexed PCR Primers are high-quality ready-to-use PCR primers for MGISEQ™ library construction. They are compatible and designed for use with all CleanPlex for MGI NGS Panels to construct targeted libraries for sequencing on an MGISEQ NGS platform.
Primer Sequences:
Each sample is indexed by a pair of Indexed PCR Primers for sequencing on MGISEQ platforms.
XXXXXXXXXX denotes the index region of the primer.
Universal Primer
5′-Phos-GAACGACATGGCTACGATCCGACT*T-3’
Indexed Primers
5′-TGTGAGCCAAGGAGTTGXXXXXXXXXXTTGTCTTCCTAAGACCGCTTGGCCTCCGACT*T-3’
Note:
Please refer to the CleanPlex for MGI NGS Panel User Guide for instructions on using CleanPlex for MGI Single-Indexed PCR Primers