CleanPlex Unique Dual-Indexed PCR Primers for Illumina, set A (96)

£676.00

96 reactions (16 indexes)

SKU: 716012 Category: Tag:

Description

The CleanPlex Unique Dual-Indexed PCR Primers for Illumina are high-quality ready-to-use PCR primers for Illumina library construction. They are compatible and designed for use with all CleanPlex and CleanPlex UMI NGS Panels to constructed targeted libraries for sequencing on an Illumina NGS platform.

Primer Sequences:

i5 Indexed Primers

5’-AATGATACGGCGACCACCGAGATCTACACXXXXXXXXACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3′

i7 Indexed Primers

5’-CAAGCAGAAGACGGCATACGAGATXXXXXXXXGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3’

Note:

Please refer to CleanPlex UMI NGS Panel User Guide for instructions on using CleanPlex Dual-Indexed PCR Primers for Illumina